View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_283 (Length: 241)
Name: NF6866A_low_283
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_283 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 22 - 174
Target Start/End: Original strand, 22837790 - 22837942
Alignment:
| Q |
22 |
agagaatggaagttcttggaaagttaagacactccaacattgttagcttaaaggcttattattttgcaagggatgaaaaattgcttgtctttgattacat |
121 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837790 |
agagaatggaaattcttggaaagttaaaacactccaacattgttagcttaaaggcttattattttgcaagggatgaaaaattgcttgtctttgattacat |
22837889 |
T |
|
| Q |
122 |
ggttaatggtagcttgttttggcttcttcatggtatgatttcttttctttctc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837890 |
ggttaatggtagcttgttttggcttcttcatggtatgatttcttttctttctc |
22837942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University