View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_288 (Length: 239)
Name: NF6866A_low_288
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_288 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 9868082 - 9867844
Alignment:
| Q |
1 |
aatataccacacacatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctctttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9868082 |
aatataccacacacatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctctttgat |
9867983 |
T |
|
| Q |
101 |
catgatttcgtcatgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataaaacttttctagacagtgtga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9867982 |
catgatttcgccatgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatggtgtga |
9867883 |
T |
|
| Q |
201 |
tccaattaccactaagatcgctactaaaggcaaaccaca |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9867882 |
tccaattaccactacgatcgctactaaaggcaaaccaca |
9867844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University