View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_292 (Length: 238)
Name: NF6866A_low_292
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_292 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 2282002 - 2281765
Alignment:
| Q |
1 |
gagtttgatcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctccaaccctccttaaatcattttattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
2282002 |
gagtttgatcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctcgaaccctccttaaatcattttatcaa |
2281903 |
T |
|
| Q |
101 |
gtttaatttagtactattaatactcaattcataactattcaattgatagaaataatttttatnnnnnnnnngtgagagaaatatcaatgttcttcgataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2281902 |
gtttaatttagtactattaatactcaattcataactattcaattgatagaaataatgtttataaaaaaaaagtgagagaaatatcaatgttcttcgataa |
2281803 |
T |
|
| Q |
201 |
gtggtggaggtagtttaatttttagggataaacatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2281802 |
gtggtggaggtagtttaatttttagggttaaacatatt |
2281765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University