View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_293 (Length: 238)
Name: NF6866A_low_293
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_293 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 37 - 221
Target Start/End: Original strand, 17811965 - 17812148
Alignment:
| Q |
37 |
agcatggttccgttgagtcgtctgttgcaggttcttctccactggaagggggatggtgtacctgcactgcacgcgctccgacactctctttcttgaaccc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
17811965 |
agcatggttccgttgagtcgtctgttgcaggttcttctccaccggaaggggggtggtgtacctgcactgcatgtgctctgaca--ctctttcttgaaccc |
17812062 |
T |
|
| Q |
137 |
ctcacttctccagccatctatgcctggggtacggacatgagtaa-ccctcggggtggtaaggagctctcggcttaatggtgaggaa |
221 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
17812063 |
ctcacttctccagccatctattcctggggtacggacatgagtaacccctcggggtggtgaggagctctcggattaatggtgaggaa |
17812148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University