View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_294 (Length: 237)
Name: NF6866A_low_294
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_294 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 3428449 - 3428571
Alignment:
| Q |
99 |
tcaatttagtttataaattgtcattctttatctaattttgcctataaattaattatcaattttgtcaaacagtctaatagttaaaatcaaacacgtgaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||| ||| |
|
|
| T |
3428449 |
tcaatttagtttataaattgtcattttttatctaattttgcctataaattaattatcaattttgtctaacaatctagtagttaaaatcaaacacgtaaaa |
3428548 |
T |
|
| Q |
199 |
tcttgagaagtggagaatctcat |
221 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
3428549 |
tcttgagaagcggagaatctcat |
3428571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 3428303 - 3428386
Alignment:
| Q |
19 |
atcacaaaataaaagaataaaaggtgatttataacaactattctttgagaatttaatgcacaaacatgaacgagctaatgtcaa |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428303 |
atcacaaaataaaagaataaaagttgatttataacaataattctttgagaatttaatgcacaaacatgaacgagctaatgtcaa |
3428386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 3431086 - 3431170
Alignment:
| Q |
19 |
atcacaaaataaaagaataaaaggtgatttataacaactattctttgagaatttaatgcacaaacatgaacgagctaatgtcaat |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||||||||||||| |||||||| | |||||| ||| |||||||||| |
|
|
| T |
3431086 |
atcacaaaataaaagaataaaagttgatttataataataattctttgagaatataatgcactagcatgaatgaggtaatgtcaat |
3431170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University