View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_301 (Length: 234)
Name: NF6866A_low_301
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_301 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 753123 - 753333
Alignment:
| Q |
14 |
ggacatcaaactgtacagagaatagtccgtgcttctgatcctctgcagtcaatgcaggatattaatcaaaatttccctagcatagtttcttatttatctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
753123 |
ggacatcaaactgtacagagaatagtccgtgcttctgatcctctgcagtcaatgcaggatattaatcaaaatttccctagcatagtttcttatttatctc |
753222 |
T |
|
| Q |
114 |
gcatgaaggtaaattttgtttgattctcagatatatggcatctttctccaaaattattaactaatattcttatggaactatgatgcacgatagcttgatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
753223 |
gcatgaaggtaaattttgtttgattctcagatatatggcatctttctccaaaattattaactaatattcttatggaactatgatgcacgatagcttgatg |
753322 |
T |
|
| Q |
214 |
atattgttcga |
224 |
Q |
| |
|
|| ||||||| |
|
|
| T |
753323 |
attctgttcga |
753333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University