View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_302 (Length: 234)
Name: NF6866A_low_302
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_302 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 215
Target Start/End: Complemental strand, 22044113 - 22043901
Alignment:
| Q |
3 |
attcctattttaaatgtcttcgctatttctggaaaaatatctttatacaactatccaaccaattattattttattcaatgaaacatatgtaatgaatgat |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22044113 |
attcctattttaaatgtctttgctatttttggaaaaatatctttatacaactatccaaccaattattattttattcaatgaaacatatgtaatgaatgat |
22044014 |
T |
 |
| Q |
103 |
aaatttatatctatatatacatcactttatgttacaacaagttcatgacttttacaatatacttgatctttcagatgaaacctataacaaaattacttct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22044013 |
aaatttatatctatatatacatcactttatgttacaacaagttcatgacttttacaatatacttgatctttcagatggaacctataacaaaattacttct |
22043914 |
T |
 |
| Q |
203 |
atccaatcctatt |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22043913 |
atccaatcctatt |
22043901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University