View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_309 (Length: 232)
Name: NF6866A_low_309
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_309 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 3429500 - 3429300
Alignment:
| Q |
14 |
agaagacaaaatgaggactatccccaccacaatgctaaacacaccccccaacaacannnnnnnaactattactccctccttatggcacactccaatccca |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429500 |
agaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactccaatccca |
3429401 |
T |
|
| Q |
114 |
tatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429400 |
tatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatg |
3429301 |
T |
|
| Q |
214 |
g |
214 |
Q |
| |
|
| |
|
|
| T |
3429300 |
g |
3429300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 3426021 - 3425822
Alignment:
| Q |
14 |
agaagacaaaatgaggactatccccaccacaatgctaaacacaccccccaacaacannnnnnnaactattactccctccttatggcacactccaatccca |
113 |
Q |
| |
|
||||||||||||||||| ||| ||||||| | |||||||||||| ||| |||| || ||||||| ||| ||||||||||||||||||||| ||| |
|
|
| T |
3426021 |
agaagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgcca |
3425922 |
T |
|
| Q |
114 |
tatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatg |
213 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |||||||||||| |
|
|
| T |
3425921 |
tatctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaagatg |
3425822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University