View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_328 (Length: 230)
Name: NF6866A_low_328
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_328 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 24125306 - 24125247
Alignment:
| Q |
3 |
gagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24125306 |
gagtgttcacttttcttattttgaaagtttccaaatgttcttttcagttagattgcttat |
24125247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 24124470 - 24124424
Alignment:
| Q |
179 |
tatcttcacagtttggtatgcaatttatgcatggctacggatggtgt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24124470 |
tatcttcacagtttggtatgcaatttatgcatggctacggatggtgt |
24124424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 87 - 133
Target Start/End: Complemental strand, 24124546 - 24124500
Alignment:
| Q |
87 |
tttggcgactctggtatcatatcgcttctttgttttatatatataat |
133 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
24124546 |
tttggcgactcttgtatcgtatctcttctttgttttatatatataat |
24124500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 62
Target Start/End: Original strand, 45163377 - 45163435
Alignment:
| Q |
3 |
gagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
62 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||| ||| | ||||||| |
|
|
| T |
45163377 |
gagtgttcactttacttattttgaaagttttcaaat-ttcttttcaattacgctgcttat |
45163435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University