View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_336 (Length: 229)
Name: NF6866A_low_336
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_336 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 223
Target Start/End: Original strand, 6024553 - 6024775
Alignment:
| Q |
3 |
acaacctcaaactacgcatgcatgttagtttcactttcatcatcagtggcttatgaatcataataaatgatgtaaccagagtatggtcctcaataaatgt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
6024553 |
acaacctcaaactacgcatgcatgttagtttcactttcatcatcagtggcttatgaatcataataaatgatgcaaccagaatatggtcctcaataaatgt |
6024652 |
T |
|
| Q |
103 |
ggtaaaatatccagcaatgcagaat--acacacaaatttaataccaactagtaaaggcatagtccatattggaagttagtgaagatatttctatactatt |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6024653 |
ggtaaaatatccagcaatgcagaatacacacacaaatttaataccaactagtaaaggcatagtccatattggaagttagtgaagatatttctatactatt |
6024752 |
T |
|
| Q |
201 |
ctttaattccttaacaaaccaac |
223 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
6024753 |
ctttaattctttaacaaaccaac |
6024775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University