View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_339 (Length: 229)
Name: NF6866A_low_339
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_339 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 5395566 - 5395353
Alignment:
| Q |
16 |
atgtagaagtacaacgaacctcacttagagaatttctccaactcgacaccactctccgccaaaatgcacaacttaaagaagctatgaattcaacctactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395566 |
atgtagaagtacaacgaacctcacttagagaatttctccaactcgacaccactctccgccaaaatgcacaacttaaagaagctatgaattcaacctactc |
5395467 |
T |
|
| Q |
116 |
acgtattcaaagccttgagaaagagcttagttgcatgaagaagtttcttcaggatcatcaagctgaggatgaaaaggagaaggagaaagaaaaagagaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395466 |
gcgtattcaaagccttgagaaagagcttagttgcatgaagaagtttcttcaggatcatcaagctgaggatgaaaaggagaaggagaaagaaaaagagaag |
5395367 |
T |
|
| Q |
216 |
gaacaaagcaatag |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5395366 |
gaacaaagcaatag |
5395353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University