View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_353 (Length: 227)
Name: NF6866A_low_353
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_353 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 5394248 - 5394435
Alignment:
| Q |
19 |
gttgacaagagtcgaagccagggcgacggcggaagaggttgtgaatctcacgcgctttcacgtcgtctgggagacccgagacgaagagtgtgttgatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5394248 |
gttgacaagagtcgaagccagggcgacggcggaagaggttgtgaatctcacgcgctttcacgtcgtctgggagaccggagacgaagagtgtgttgatgtt |
5394347 |
T |
|
| Q |
119 |
gctccgttcgtcttgttggtaatggtaatactggtcaaattgttgcatagccattccgagggttgcgctggtgaagatgaaagggtga |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5394348 |
gctccgttcgtcttgttggtagtggtaatactgatcaaattgttgcatagccattccgagggttgcgctggtgaagatgaaagggtga |
5394435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University