View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_387 (Length: 216)
Name: NF6866A_low_387
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_387 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 44187453 - 44187662
Alignment:
| Q |
1 |
aataattttctactctaacaccaaactcctcaatcaccccggtagtcaagtctaaacaagctagttcataatttggtgttctgaagaatatattgccctc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44187453 |
aataattttctactctaacaccaatctcctcaatcaccccggtagtcaagtctaaacaagctagttcataatttggtgttctgaagaatatattgccctc |
44187552 |
T |
 |
| Q |
101 |
tttccaagctccgataggatttggaatgcaagccaaaacaggttcagtagaatgttgaatgggaaaaggatcaacattgaagagtctaacccaggattcc |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44187553 |
tttccaagctccggtaggatttggaatgcaagccaaaaaaggttcagtagaatgttgaatgggaaaaggatcaacattgaagagtctaacccaggattcc |
44187652 |
T |
 |
| Q |
201 |
ttaacaccaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
44187653 |
ttaacaccaa |
44187662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 19163116 - 19163166
Alignment:
| Q |
16 |
taacaccaaactcctcaatcaccccggtagtcaagtctaaacaagctagtt |
66 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| || || ||||||||||||| |
|
|
| T |
19163116 |
taacaccaatctcctcaatcatcccggtagttaaatcaaaacaagctagtt |
19163166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University