View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_399 (Length: 211)
Name: NF6866A_low_399
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_399 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 23 - 169
Target Start/End: Complemental strand, 15420376 - 15420230
Alignment:
| Q |
23 |
atggtttgcattcaaaataaaattatttgtcttggataatggtagatccttgtagacatgcatcatttctgagatttcataatgatcttacttcaacatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15420376 |
atggtttgcattcaaaataaaattatttgtcttggataatggtagatccttgtagacatgcatcatttctgagatttcataatgatcttatttcaacatt |
15420277 |
T |
 |
| Q |
123 |
ttttgttttggttaggagaaactattaataattaaaatgacgttgat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420276 |
ttttgttttggttaggagaaactattaataattaaaatgacgttgat |
15420230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University