View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6866A_low_406 (Length: 207)

Name: NF6866A_low_406
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6866A_low_406
NF6866A_low_406
[»] chr4 (1 HSPs)
chr4 (21-207)||(36170376-36170562)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 36170376 - 36170562
Alignment:
21 gttggtgttgaggaagttaagagatttatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt 120  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36170376 gttggtgttgaggaagttaagagattcatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt 36170475  T
121 caatagggttcattcagaatattgcctttggagatgagttggttaggcaaacggtgattagagaaggcggaatccgtgctttgttac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
36170476 caatagggttcattcagaatattgcctttggagatgagttggttaggcaaatggtgattagagaaggcggaatccgtgctttgttac 36170562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University