View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_410 (Length: 206)
Name: NF6866A_low_410
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_410 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 37 - 162
Target Start/End: Complemental strand, 8638041 - 8637920
Alignment:
| Q |
37 |
gactgattgcaatgaagtagtgcatctttatgagttcattgtcgttcttggnnnnnnnnaacaggttgtcgttgttctttgcttaatcaaattatatgcc |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8638041 |
gactgattgcaatgaagtagtgcatctttatgagttcattgtcgttcttggttttttttaacaggttgtcgttgttctttgcgtaatcaaattatatgcc |
8637942 |
T |
|
| Q |
137 |
tatatatatagcttgatgagtcccaa |
162 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8637941 |
----tatatagcttgatgagtcccaa |
8637920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 35111709 - 35111774
Alignment:
| Q |
141 |
tatatagcttgatgagtcccaattgaaaagggcagcttctagaaaatttaacttcataagccctca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35111709 |
tatatagcttgatgagtcccaattgaaaagggcaacttctagaaaatttaacttcataagccctca |
35111774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 6757716 - 6757660
Alignment:
| Q |
141 |
tatatagcttgatgagtcccaattgaaaagggcagcttctagaaaatttaacttcat |
197 |
Q |
| |
|
|||||||||||||||||||||||||| || || | |||||| ||||||||||||||| |
|
|
| T |
6757716 |
tatatagcttgatgagtcccaattgagaaaggtaacttctataaaatttaacttcat |
6757660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 6757783 - 6757736
Alignment:
| Q |
40 |
tgattgcaatgaagtagtgcatctttatgagttcattgtcgttcttgg |
87 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
6757783 |
tgattgcaatgaaatagtgcacctttatgagttcattgtagttcttgg |
6757736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University