View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_426 (Length: 201)
Name: NF6866A_low_426
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_426 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 21 - 185
Target Start/End: Original strand, 33119954 - 33120118
Alignment:
| Q |
21 |
ataggatggttggcaatagttggtttagcagtctacataatattcttttcaccaggaatgggaactgttccatgggttatcaactctgaaatataccctt |
120 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
33119954 |
ataggatggttggcgatagttggtttagcagtctacataatattcttttcaccaggaatgggaacggttccatgggttatcaactctgaaatacaccctt |
33120053 |
T |
|
| Q |
121 |
taaggtatagaggaatatgtggaggaatagcatcaacaacagtgtgggtctctaacctcattgtt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120054 |
taaggtatagaggaatatgtggaggaatagcatcaacaacagtgtgggtctctaacctcattgtt |
33120118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 63 - 185
Target Start/End: Original strand, 33116784 - 33116906
Alignment:
| Q |
63 |
ttcttttcaccaggaatgggaactgttccatgggttatcaactctgaaatataccctttaaggtatagaggaatatgtggaggaatagcatcaacaacag |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| || |||||||| || ||||||||||||||||||||| | ||||||||||| || ||||||| | |
|
|
| T |
33116784 |
ttcttttcacctggaatggggactgttccatgggtcataaactctgagatttaccctttaaggtatagaggagtctgtggaggaatggcttcaacaagtg |
33116883 |
T |
|
| Q |
163 |
tgtgggtctctaacctcattgtt |
185 |
Q |
| |
|
| ||| |||| ||||| |||||| |
|
|
| T |
33116884 |
tttggatctcaaaccttattgtt |
33116906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 9e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 52 - 178
Target Start/End: Complemental strand, 21492025 - 21491899
Alignment:
| Q |
52 |
tctacataatattcttttcaccaggaatgggaactgttccatgggttatcaactctgaaatataccctttaaggtatagaggaatatgtggaggaatagc |
151 |
Q |
| |
|
||||||| |||||||| || || ||||||||||| |||||||||||| | ||||||||||| || || || ||||||||||||||||||||||||||||| |
|
|
| T |
21492025 |
tctacatcatattcttctcgcctggaatgggaacagttccatgggttgttaactctgaaatctatccattgaggtatagaggaatatgtggaggaatagc |
21491926 |
T |
|
| Q |
152 |
atcaacaacagtgtgggtctctaacct |
178 |
Q |
| |
|
|||||||||||||||||| || ||||| |
|
|
| T |
21491925 |
atcaacaacagtgtgggtttccaacct |
21491899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 61 - 158
Target Start/End: Complemental strand, 21558576 - 21558479
Alignment:
| Q |
61 |
tattcttttcaccaggaatgggaactgttccatgggttatcaactctgaaatataccctttaaggtatagaggaatatgtggaggaatagcatcaaca |
158 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| | |||||||||||||| || ||||| || |||||||||||||||||||| || |||||| |
|
|
| T |
21558576 |
tattcttctcaccaggaatgggaacagttccatgggttgtaaactctgaaatatatccattaagatacagaggaatatgtggaggaatcgcgtcaaca |
21558479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University