View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_47 (Length: 403)
Name: NF6866A_low_47
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 23 - 299
Target Start/End: Complemental strand, 33246228 - 33245961
Alignment:
| Q |
23 |
agatcatgcttcctactccgatgacggcggtgtcgagttcttatttttctgttacttcttcttctgttcatcaacagcgtcaagagtttttcactttcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246228 |
agatcatgcttcctactccgatgacggcggtgtcgagttcttatttttctgttacttcttcttctgttcatcaacagcgtcaagagtttttcactttcaa |
33246129 |
T |
|
| Q |
123 |
tgctgaaaactcgttttctaataactttcagatgaacccttttcagaatcagttaatggttnnnnnnnnnnnnnnnnnncaggcacaatcttcacaaccc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33246128 |
tgctgaaaactcgttttctaataactttcagatgaacccttttcagaatcagttaatggtt---------tcatcatcacaggcacaatcttcacaaccc |
33246038 |
T |
|
| Q |
223 |
atcaacccatttttgtcaaagaaggttttcaaggctgaaagggacaaccttggagagggtatgatcactgtttcatc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246037 |
atcaacccatttttgtcaaagaaggttttcaaggctgaaagggacaaccttggagagggtatgatcactgtttcatc |
33245961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 350 - 389
Target Start/End: Complemental strand, 33245910 - 33245871
Alignment:
| Q |
350 |
gaatggttctgttaggtaatcttatgtgatgatcttcata |
389 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33245910 |
gaatggttctgttaggtaatcttatatgatgatcttcata |
33245871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University