View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_65 (Length: 365)
Name: NF6866A_low_65
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 7 - 350
Target Start/End: Complemental strand, 20487240 - 20486897
Alignment:
| Q |
7 |
taaagttcacgcttccattgacaaatttgacacgtccagtgggataatatgaccattaccattgaaaaattatcttcccccagtcagaacaatgtttatt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
20487240 |
taaaattcacgcttccattgacaaatttgacatgtccagtgggacaatatgaccattaccattgaaaaattatcttccctcagtcaggacaatgtctatt |
20487141 |
T |
|
| Q |
107 |
gtatgcattggaggtctggaaagggtctcaacaatatgaaacaaccgccatcttcagcaactagaaagtcagtgcagcgttgacttaaggatcattcgca |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
20487140 |
gtatgcattggaggtctggaaagagtctcaacaatatgaaacaaccaccatcttcagcaaccagaaagtcagtgcagccttgacttaaggatctttcgca |
20487041 |
T |
|
| Q |
207 |
aacgttgagagtgccaacatatatggatacttctagcgtttcaaaggtataacttgtcaaaacatcatagaagttattagtaatgacaacgtctttcatt |
306 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||| ||||||| | |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20487040 |
aacgttgggagtgccaacatatatggatccttctagcgtttcagaggtatagcctgtcaaaacatcatagaatttattagtaatgacaacgtctttcatt |
20486941 |
T |
|
| Q |
307 |
agacaatatattaacatgagattaatgacagtctttcataccat |
350 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
20486940 |
agacaatatattaacatgggattaatgacaatctttcataccat |
20486897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 324
Target Start/End: Original strand, 21770689 - 21770729
Alignment:
| Q |
284 |
tagtaatgacaacgtctttcattagacaatatattaacatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
21770689 |
tagtaatgacaacgtctttcattagacatcatattgacatg |
21770729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University