View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_76 (Length: 352)
Name: NF6866A_low_76
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 96 - 216
Target Start/End: Original strand, 24034411 - 24034531
Alignment:
| Q |
96 |
tggtgttgctggccttgatgcactccctgatcaggaggatgatcctcttttgatgtgcagttgttcaaattactaatgttctttctgtctatattttggt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24034411 |
tggtgttgctggccttgatgcactccctgatcaggaggatgatcctcttttgatgtgcagttgttcaaattactaatgttttttctgtctatattttggt |
24034510 |
T |
 |
| Q |
196 |
tggcacatccattctatttat |
216 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24034511 |
tggcacatccattctatttat |
24034531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University