View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6866A_low_76 (Length: 352)

Name: NF6866A_low_76
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6866A_low_76
NF6866A_low_76
[»] chr1 (1 HSPs)
chr1 (96-216)||(24034411-24034531)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 96 - 216
Target Start/End: Original strand, 24034411 - 24034531
Alignment:
96 tggtgttgctggccttgatgcactccctgatcaggaggatgatcctcttttgatgtgcagttgttcaaattactaatgttctttctgtctatattttggt 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
24034411 tggtgttgctggccttgatgcactccctgatcaggaggatgatcctcttttgatgtgcagttgttcaaattactaatgttttttctgtctatattttggt 24034510  T
196 tggcacatccattctatttat 216  Q
    |||||||||||||||||||||    
24034511 tggcacatccattctatttat 24034531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University