View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_85 (Length: 343)
Name: NF6866A_low_85
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 68 - 221
Target Start/End: Complemental strand, 54828195 - 54828042
Alignment:
| Q |
68 |
gttgttcagtggctgtgatggtggccaggcaatttttctttgatcttatcaagtatacccttcttctcatgagttggctcagctgggtgatgggttgcag |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54828195 |
gttgttcagtggctgtgatggtggccaggcaatttttctttgatcttatcaagtatacccttcttctcaagagttggctcagctgggtgatgggttgcag |
54828096 |
T |
|
| Q |
168 |
ttgccgtagggtggtgacctgcacctggaatactggttgcactattatgctcct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54828095 |
ttgccgtagggtggtgacctgcacctggaatactggttgcactattatgctcct |
54828042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University