View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_high_24 (Length: 248)
Name: NF6867A_high_24
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_high_24 |
 |  |
|
| [»] scaffold0530 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0530 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0530
Description:
Target: scaffold0530; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 22 - 207
Target Start/End: Complemental strand, 8046 - 7861
Alignment:
| Q |
22 |
ataaatggcagggattggatactgcaattgttaaggcaacaaactttgatcatgcattgccaaaggaaaaacatattcgatgtatatcgtattctttttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046 |
ataaatggcagggattggatactgcaattgttaaggcaacaaactttgatcatgcattgccaaaggaaaaacatattcgatgtatatcgtattctttttc |
7947 |
T |
 |
| Q |
122 |
ttttattcaatgcaatgcaattgatccttagttacaagctttgttggagaatgtatgtgaagagtataaagattgtatgttgatgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7946 |
ttttattcaatgcaatgcaattgatccttagttacaagctttgttggagaatgtatgtgaagagtataaagattgtatgttgatgt |
7861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University