View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_high_25 (Length: 244)
Name: NF6867A_high_25
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 3016176 - 3015941
Alignment:
| Q |
8 |
tatcatagatgatggatttgtcagcattttgtgattgtcttagagttagattatcatttttaagatcttacatattaatattcttctaccattgtaagta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||| ||||||||| |
|
|
| T |
3016176 |
tatcatagatgatggatttgtcagcattttatgattgtcttagagttagattatcatttttaagatcatacatatcaatattcgtctaccgttgtaagta |
3016077 |
T |
 |
| Q |
108 |
aacaggcttgaggaataaaaagagaaaattgaagggggnnnnnnngctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016076 |
aacaggcttgaggaataaaaagagaaaattgaagggggaaaaaaagctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatgt |
3015977 |
T |
 |
| Q |
208 |
ttgaacttgttctcactattattacaattccatgga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015976 |
ttgaacttgttctcactattattacaattccatgga |
3015941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University