View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_107 (Length: 340)
Name: NF6867A_low_107
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_107 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 5161253 - 5161086
Alignment:
| Q |
1 |
agaacaattcttcatttcatatcaattggtttcttacaaacagaacagaagtttgaagaaattaactttcaatgacaaacgctaatttctaccattttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
5161253 |
agaacaattcttcatttcatatcaattagtttcttacaaacagaacaggagtttgaagaaattaaccttcaatgagaaacactaatttctaccattttcc |
5161154 |
T |
|
| Q |
101 |
aatctctttctttggacaagaggttcaatgattttcactcccgaaaatatatctagaatattttacaa |
168 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5161153 |
aatctctttctttgaacaagaggttcaatgattttcactccccaaaatatatctagaatattttacaa |
5161086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University