View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_117 (Length: 332)
Name: NF6867A_low_117
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_117 |
 |  |
|
| [»] chr7 (6 HSPs) |
 |  |
|
| [»] chr2 (12 HSPs) |
 |  |
|
| [»] scaffold0048 (1 HSPs) |
 |  |
|
| [»] chr6 (8 HSPs) |
 |  |
|
| [»] scaffold0991 (1 HSPs) |
 |  |
|
| [»] scaffold0497 (1 HSPs) |
 |  |
|
| [»] scaffold0431 (1 HSPs) |
 |  |
|
| [»] scaffold0156 (1 HSPs) |
 |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] chr8 (7 HSPs) |
 |  |
|
| [»] chr4 (8 HSPs) |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 105 - 299
Target Start/End: Original strand, 22042553 - 22042746
Alignment:
| Q |
105 |
tgtgcacattgaagaagtataacaacactgcagagtagtaaaacaaaataaaattagcagttaggaaaactgaaaatatagaatacctgatatggaagat |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| | | ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22042553 |
tgtgcacattgaagaagtataacaacagtgcagagtagtataacaacagtgcag-agcagttaggaaagctgaaaatatagaatacctgatatggaagat |
22042651 |
T |
 |
| Q |
205 |
gtacagtttcaaaacctcccagaacttgtcttttaagcacatcacgatatccagccatttcaagtggaaagagtagttaaagatgatgtagttat |
299 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| ||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
22042652 |
gtacagtttcaaaacctcctagaatttgtcttttaagtacaacacgatatccagccatttgaagtggaaagagttgttaaagatgatgtagttat |
22042746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 20398701 - 20398667
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
20398701 |
atgtcataccccaaattttgaccacttttctctat |
20398667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 19223555 - 19223588
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
19223555 |
tgtcataccccaaattttgaccacttttctctat |
19223588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 20372978 - 20372945
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
20372978 |
tgtcataccccaaattttgaccacttttctctat |
20372945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 24956911 - 24956878
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
24956911 |
tgtcataccccaaattttgaccacttttctctat |
24956878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 24965374 - 24965341
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
24965374 |
tgtcataccccaaattttgaccacttttctctat |
24965341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 29186343 - 29186310
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
29186343 |
tgtcataccccaaattttgaccacttttctctat |
29186310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 46687490 - 46687400
Alignment:
| Q |
14 |
cgaaagatacgtcggcattgccgtcgtgcctcccggcatcgatcctcagacaaacgttatctccaaagaccccacaatcatcccagaaacc |
104 |
Q |
| |
|
||||||||| | ||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46687490 |
cgaaagatatgccggcattgccgtcgttcctcccggcatcgatcctcatacaaacgttatctccaaagacatcacaatcatcccagaaacc |
46687400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 28470283 - 28470249
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
28470283 |
atgtcataccccaaattttgaccacttttctctat |
28470249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Original strand, 50824351 - 50824385
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
50824351 |
atgtcataccccaaattttgaccacttttctctat |
50824385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 50851509 - 50851475
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
50851509 |
atgtcataccccaaattttgaccacttttctctat |
50851475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 30541 - 30508
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
30541 |
tgtcataccccaaattttgaccacttttctctat |
30508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 8197761 - 8197728
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
8197761 |
tgtcataccccaaattttgaccacttttctctat |
8197728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 14538670 - 14538637
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
14538670 |
tgtcataccccaaattttgaccacttttctctat |
14538637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 17628265 - 17628298
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17628265 |
tgtcataccccaaattttgaccacttttctctat |
17628298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 17919199 - 17919232
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17919199 |
tgtcataccccaaattttgaccacttttctctat |
17919232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 27341400 - 27341367
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
27341400 |
tgtcataccccaaattttgaccacttttctctat |
27341367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 30244775 - 30244808
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30244775 |
tgtcatacctcaaattttgaccacttttctctat |
30244808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 4941642 - 4941609
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
4941642 |
tgtcataccccaaattttgaccacttttctctat |
4941609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 4952462 - 4952429
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
4952462 |
tgtcatacctcaaattttgaccacttttatctat |
4952429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 10439937 - 10439970
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
10439937 |
tgtcataccccaaattttgaccacttttctctat |
10439970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 12978455 - 12978488
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
12978455 |
tgtcataccccaaattttgaccacttttctctat |
12978488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 18304457 - 18304424
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
18304457 |
tgtcataccccaaattttgaccacttttctctat |
18304424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 297 - 332
Target Start/End: Complemental strand, 20372380 - 20372345
Alignment:
| Q |
297 |
tatgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20372380 |
tatgtcataccccaaattttgaccacttttctctat |
20372345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 14582925 - 14582958
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
14582925 |
tgtcataccccaaattttgaccacttttctctat |
14582958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 15944622 - 15944589
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
15944622 |
tgtcataccccaaattttgaccacttttctctat |
15944589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 15953137 - 15953104
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
15953137 |
tgtcataccccaaattttgaccacttttctctat |
15953104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 17687463 - 17687430
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17687463 |
tgtcataccccaaattttgaccacttttctctat |
17687430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 20621518 - 20621551
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
20621518 |
tgtcataccccaaattttgaccacttttctctat |
20621551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 25483601 - 25483634
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
25483601 |
tgtcataccccaaattttgaccacttttctctat |
25483634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 25491207 - 25491240
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
25491207 |
tgtcataccccaaattttgaccacttttctctat |
25491240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 35138593 - 35138626
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
35138593 |
tgtcataccccaaattttgaccacttttctctat |
35138626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 35146929 - 35146962
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
35146929 |
tgtcataccccaaattttgaccacttttctctat |
35146962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 41233909 - 41233876
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
41233909 |
tgtcataccccaaattttgaccacttttctctat |
41233876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 42249520 - 42249487
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
42249520 |
tgtcataccccaaattttgaccacttttctctat |
42249487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 7695 - 7661
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
7695 |
atgtcataccccaaattttgaccacttttctctat |
7661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Original strand, 5004060 - 5004094
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
5004060 |
atgtcataccccaaattttgaccacttttctctat |
5004094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 5489185 - 5489151
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
5489185 |
atgtcataccccaaattttgaccacttttctctat |
5489151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Original strand, 25550294 - 25550328
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
25550294 |
atgtcataccccaaattttgaccacttttctctat |
25550328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 35091742 - 35091708
Alignment:
| Q |
298 |
atgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
35091742 |
atgtcataccccaaattttgaccacttttctctat |
35091708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 5994699 - 5994732
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
5994699 |
tgtcataccccaaattttgaccacttttctctat |
5994732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 13490193 - 13490226
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
13490193 |
tgtcataccccaaattttgaccacttttctctat |
13490226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 23925335 - 23925368
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23925335 |
tgtcataccccaaattttgaccacttttctctat |
23925368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 30824594 - 30824561
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
30824594 |
tgtcataccccaaattttgaccacttttctctat |
30824561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0991 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0991
Description:
Target: scaffold0991; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 438 - 405
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
438 |
tgtcataccccaaattttgaccacttttctctat |
405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0497 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0497
Description:
Target: scaffold0497; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 10993 - 11026
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
10993 |
tgtcataccccaaattttgaccacttttctctat |
11026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0431 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0431
Description:
Target: scaffold0431; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 139 - 172
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
139 |
tgtcataccccaaattttgaccacttttctctat |
172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0156 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0156
Description:
Target: scaffold0156; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 35421 - 35388
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
35421 |
tgtcataccccaaattttgaccacttttctctat |
35388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 33035 - 33068
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
33035 |
tgtcataccccaaattttgaccacttttctctat |
33068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 15813 - 15846
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
15813 |
tgtcataccccaaattttgaccacttttctctat |
15846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 40898 - 40865
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
40898 |
tgtcataccccaaattttgaccacttttctctat |
40865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 23464 - 23497
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23464 |
tgtcataccccaaattttgaccacttttctctat |
23497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 192528 - 192561
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
192528 |
tgtcataccccaaattttgaccacttttctctat |
192561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 121228 - 121261
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
121228 |
tgtcataccccaaattttgaccacttttctctat |
121261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 4582204 - 4582237
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
4582204 |
tgtcataccttaaattttgaccacttttctctat |
4582237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 17664705 - 17664672
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17664705 |
tgtcataccccaaattttgaccacttttctctat |
17664672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 17683861 - 17683828
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17683861 |
tgtcataccccaaattttgaccacttttctctat |
17683828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 17973565 - 17973598
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
17973565 |
tgtcataccccaaattttgaccacttttctctat |
17973598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 26873669 - 26873636
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
26873669 |
tgtcataccccaaattttgaccacttttctctat |
26873636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 26876119 - 26876086
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
26876119 |
tgtcataccccaaattttgaccacttttctctat |
26876086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 30938282 - 30938315
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
30938282 |
tgtcataccccaaattttgaccacttttctctat |
30938315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 8094347 - 8094314
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
8094347 |
tgtcataccccaaattttgaccacttttctctat |
8094314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 8103153 - 8103120
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
8103153 |
tgtcataccccaaattttgaccacttttctctat |
8103120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 10638328 - 10638361
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
10638328 |
tgtcataccccaaattttgaccacttttctctat |
10638361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 12428543 - 12428510
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
12428543 |
tgtcataccccaaattttgaccacttttctctat |
12428510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 12996476 - 12996509
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
12996476 |
tgtcataccccaaattttgaccacttttctctat |
12996509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 21532369 - 21532336
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
21532369 |
tgtcataccccaaattttgaccacttttctctat |
21532336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 27343756 - 27343723
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
27343756 |
tgtcataccccaaattttgaccacttttctctat |
27343723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 52295604 - 52295637
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
52295604 |
tgtcataccccaaattttgaccacttttctctat |
52295637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 21498963 - 21498930
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
21498963 |
tgtcataccccaaattttgaccacttttctctat |
21498930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 31539954 - 31539987
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
31539954 |
tgtcataccccaaattttgaccacttttctctat |
31539987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 31548523 - 31548556
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
31548523 |
tgtcataccccaaattttgaccacttttctctat |
31548556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Complemental strand, 35104129 - 35104096
Alignment:
| Q |
299 |
tgtcatacctcaaattttgaccacttttctctat |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
35104129 |
tgtcataccccaaattttgaccacttttctctat |
35104096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University