View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_128 (Length: 320)
Name: NF6867A_low_128
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_128 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 320
Target Start/End: Complemental strand, 32164808 - 32164496
Alignment:
| Q |
8 |
caatgagttattattgactctcgagctagacaatcttgcttctaccacaaggccatttactaactctgctgatcttttggtcactttacctcctcggacc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32164808 |
caatgagttattattgactctcgagctagacaatcttgcttctactacaaggccatttactaactctgctgatcttttggtcactttacctcctcgaacc |
32164709 |
T |
|
| Q |
108 |
catcagctcctgccaagctcttcgattcttatgcctgaacggttatctccagctttacaagactcaatttcaggacatgcacatctgcggtagggtgatt |
207 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||| |
|
|
| T |
32164708 |
catcagcttctgccaagctcttcgaatcttatgcctgaacggttatctccagctttacaagactcattttcagaacatgcacatctccggtagggtgatt |
32164609 |
T |
|
| Q |
208 |
ataaaaccagtccagctgcttgttaagaaggtaatttttctttatgatcacacacgatcatgaaaaaagtagatatgaacaaactgccacattgacatgt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32164608 |
ataaaaccagtccagctgcttgttaagaaggtaatttttctttatgatcacacacgatcatgagcaaagtagatatgatcaaactgccacattgacatgt |
32164509 |
T |
|
| Q |
308 |
gtagtattgttga |
320 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32164508 |
gtagtattgttga |
32164496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University