View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_156 (Length: 297)
Name: NF6867A_low_156
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_156 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 77 - 285
Target Start/End: Original strand, 8856204 - 8856412
Alignment:
| Q |
77 |
caatccaaacggagcctgaaataggcgatgatacgaatctcatatttcttcccttggttatagggattttgttgatttcatttttgcaattatattgaat |
176 |
Q |
| |
|
|||||||||| |||||||| |||| | ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8856204 |
caatccaaacagagcctgagatagacaatgatacgaatctgatatttcttcccttagttatagggattttgttgatttcatttttgcaattatattgaat |
8856303 |
T |
|
| Q |
177 |
cgattattttcaagaaaatagagaacgcgattaacactaatgaattgcaagtatcttattttatacaatcatttcagatcaccactagtcaataccatga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8856304 |
cgattattttcaagaaaatagagaacgcgattaacactaatgaattgcaagtatcttactttatacaatcatttcagatcatcactagtcaataccatga |
8856403 |
T |
|
| Q |
277 |
atccatatt |
285 |
Q |
| |
|
||||||||| |
|
|
| T |
8856404 |
atccatatt |
8856412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University