View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_157 (Length: 297)
Name: NF6867A_low_157
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_157 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 127 - 280
Target Start/End: Original strand, 41786026 - 41786179
Alignment:
| Q |
127 |
gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgcgaccggtgtaactatctaatga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41786026 |
gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgcgaccggtgtaactatctaatga |
41786125 |
T |
|
| Q |
227 |
atttggtcgcaagtatgagagttaataagaagacatgaactttcttttttctgc |
280 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41786126 |
atttggtcacaagtatgagagttaataagaagacatgaactttcttttttctgc |
41786179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 41785906 - 41785983
Alignment:
| Q |
7 |
aaagtatggaatttagaagccacagtgagcaaagaaggaggagagaaattgaacttgacaaatgcagtgagccagctt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785906 |
aaagtatggaatttagaagccacagtgagcaaagaaggaggagagaaattgaacttgacaaatgcagtgagccagctt |
41785983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University