View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_178 (Length: 287)
Name: NF6867A_low_178
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_178 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 39 - 287
Target Start/End: Complemental strand, 44866144 - 44865896
Alignment:
| Q |
39 |
gtgagcctcactgtctgtgcaaaactatgaatagccgtggtttgcgaaagtatatacttatgcatctatctgaaacgccgtcgcttaaggaaaaaatccc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44866144 |
gtgagcctcactgtctgtgcaaaactatgaatagccgtggtttgcgaaagtatatacttatgcatctatctgaaacgccgtcgcttgaggaaaaaatccc |
44866045 |
T |
|
| Q |
139 |
ggtggcgctgaaaaaggcgccggaaccggcaaaattggtgtttgaatgcattggtagattttaccttcaaggaagcaaagcctatacaacaaactcaccg |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866044 |
ggtggcactgaaaaaggcgccggaaccggcaaaattggtgtttgaatgcattggtagattttaccttcaaggaagcaaagcctatacaacaaactcaccg |
44865945 |
T |
|
| Q |
239 |
atgattactgcaaggcaagcttcaattttggttttggaatactatctga |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865944 |
atgattactgcaaggcaagcttcaattttggttttggaatactatctga |
44865896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University