View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_184 (Length: 284)
Name: NF6867A_low_184
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_184 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 4 - 154
Target Start/End: Original strand, 32167682 - 32167833
Alignment:
| Q |
4 |
attccaactaggagaaacattaagacatttactaaaaatgnnnnnnnnn-gatggaaaaagtgattatgaagccaataattagtctcgtgaacacaattt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32167682 |
attccaactaggagaaacattaagacatttactgaaaatgaaaaaagaaagatggaaaaagtgattatgaagccaataattagtctcgtgaacacaattt |
32167781 |
T |
 |
| Q |
103 |
acacaactccggttagggatgagaattagaagaacaaggaagaagaggttcc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32167782 |
acacaactccggttagggatgagaattagaagaacaaggaagaagaggttcc |
32167833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 215 - 272
Target Start/End: Original strand, 32167860 - 32167917
Alignment:
| Q |
215 |
ggtcaaaactattgttgcttgtaatttgtctgttttcaatttttgtttacaaagatga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32167860 |
ggtcaaaactattgttgcttgtaatttgtctgttttcaatttttgtttacaaagatga |
32167917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University