View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_185 (Length: 283)
Name: NF6867A_low_185
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_185 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 32167703 - 32167425
Alignment:
| Q |
1 |
taatgtttctcctagttggaatttgtttggtcagcaattttatgcaatcaaaatccggaatctaatgtcttttgagcaaatcaaacctttaactttttt- |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32167703 |
taatgtttctcctagttggaatttgtttggtctgcaattttatgcaatcaaaatccggaatctaatgtcttttgagcaaatcaaacctttaacttttttt |
32167604 |
T |
|
| Q |
100 |
atgttggaattggacgcggttttaaaatcttcaa-----ggataactaacatttcctgtgtatatagatcgttatgcacatcttctttaattttgaggta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32167603 |
atgttggaattggacgcggttttaaaatcttcaacttaaggataactaacatttccaatgtatatagaacgttatgcacatcttctttaattttgaggta |
32167504 |
T |
|
| Q |
195 |
tttcatatacttgtcctttagaaaaggtagataaagttcaaccaaggtctctttaaccgcattactctccctattaaca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32167503 |
tttcatatacttgtcctttagaaaaggtatataaagttcaaccaaggtctctttagctgcattactctccctattaaca |
32167425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University