View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_212 (Length: 268)
Name: NF6867A_low_212
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_212 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 2162955 - 2163213
Alignment:
| Q |
1 |
tcaggtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatttgagagtaaaacacatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2162955 |
tcaggtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatgtgagagtaaaacacatagc |
2163054 |
T |
|
| Q |
101 |
cccagttaaatcatatattttatttgtgaggacagagtcagtagcggagtggctgttctgaaaagaatttaggttatttctttataaaaagtggtgttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2163055 |
cccagttaaatcatatattttatttgtgaggacagagtcagtagtggagtggctgttctgaaaagaatttaggttatttctttataaaaagcggtgttag |
2163154 |
T |
|
| Q |
201 |
attttgatgtcactttttaactattaactggtcttttataactttcgatagtgtatcttgg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2163155 |
attttgatgtcactttttaactattaactggtcttt--taactttctatagtgtatcttgg |
2163213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University