View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_219 (Length: 264)
Name: NF6867A_low_219
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_219 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 249
Target Start/End: Original strand, 41983035 - 41983264
Alignment:
| Q |
21 |
atgcttttctttatccaaatacaaaatgattgctatgaggtgcttctctctctgcatgtaactaagatagaagataacatggacagatgtttggatcctc |
120 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983035 |
atgcttttctttattcaaatacaaaatgattgctatgaggtgcttctctctctgcatgtaactaagatagaagataacatggacagatgtttggatcctc |
41983134 |
T |
|
| Q |
121 |
tacggccctactaaggctccaaggaaatctcagacgaaggattgatctgac-ggtttcgagatcaaaatttgattggtcagattaatccaataagcgata |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
41983135 |
tacggccctactaaggctccaacaaaatctcagacgaaggattgatctgacgggtttcgagatcaaaatttgattggttagattaatccaataagcgaga |
41983234 |
T |
|
| Q |
220 |
ttaggcagaaaaaggtggaacgctaaagag |
249 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |
|
|
| T |
41983235 |
ttaggcagaaaaagatggagcgctaaagag |
41983264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University