View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_248 (Length: 253)
Name: NF6867A_low_248
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_248 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 47094045 - 47094287
Alignment:
| Q |
11 |
ttattctgtaaactgagtacacggagttggtcgagattggagagtgtccgagaaggaaaaacaccaccgcgatctaagttgaggagaatgagacgaatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
47094045 |
ttattctgtaaactgagtacacggagttggtcgagattggagagtgtccgagaaggaaaaaaaccaccgagatctaagttgcggagaatgagacgaatga |
47094144 |
T |
|
| Q |
111 |
ctttgtgttcgttgttgcattctacgccttgccagttgcagaatggggttttggttgtgaagttgaggtggttgtttaggtcagcttttgatttgaatgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47094145 |
ctttgtgttcgttgttgcattctacgccttgccagttgcagaatggggttttggttgtgaagttgaggtggttgtttaggtcagcttttgatttgaatgc |
47094244 |
T |
|
| Q |
211 |
taaaagagatgtaggatctgagagagagggtttggttttgttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47094245 |
taaaagagatgtaggatctgagagagagggtttggttttgttg |
47094287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University