View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_249 (Length: 253)
Name: NF6867A_low_249
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_249 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 247
Target Start/End: Original strand, 40924837 - 40925069
Alignment:
| Q |
14 |
gatggacatcctcaaagaaatgtacttgttgttacctgcattgtgtcttcattggactcaatcttgctccggcggtagtgcctgcacgacgttcaactca |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40924837 |
gatgaacatcctcaaagaaatgtacttgttgttacctgtattgtgtcttcattggactcaatcttgctccggcggtagtgcctgcacgacgt-caactca |
40924935 |
T |
 |
| Q |
114 |
gtgaggggcaaaggtgccaccgctgcccgtggtggtttgggaggtgaacgcagccattttaagaaagttggactgtttgccaagatcaatatcactgcaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
40924936 |
gtgaggggcaaaggtgccaccgctgcccgtggtggtttgggaggtgaacgcagccattttaagaaagttggaccgtatgccaagatcaatatcactgcaa |
40925035 |
T |
 |
| Q |
214 |
tagcaaccacaacaatggaagcaaacagtataag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40925036 |
tagcaaccacaacaatggaagcaaacagtataag |
40925069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University