View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_279 (Length: 249)
Name: NF6867A_low_279
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_279 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 2 - 249
Target Start/End: Complemental strand, 21832008 - 21831764
Alignment:
| Q |
2 |
taggatgcataatttcatgataatcagcattcgtctcttacatcaaatatggtatcaacaaaacaagttcatcttatagagatctcatcaaccacatgga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832008 |
taggatgcataatttcatgataatcagcattcgtctcttacaccaaatatggtatcaacaaaacaagttcatcttatagagatctcatcaaccacatgga |
21831909 |
T |
 |
| Q |
102 |
gttcgaacttgaaataacctgaaaatacatttaaaataagcnnnnnnnnnnnnnnnnctttgtagaccgataaaaacatcaatgaggacattagatctca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21831908 |
gttcgaacttgaaataacctgaaaatacatttaaaataagc---aaaaaaaaaaaaactttgtagaccgataaaaacatcaatgaggacattagatctca |
21831812 |
T |
 |
| Q |
202 |
aacatggtattaatggagtgatcaaataccacgatcgctttcgaggag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21831811 |
aacatggtattaatggagtgatcaaataccacgatggctttcgaggag |
21831764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University