View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_283 (Length: 249)
Name: NF6867A_low_283
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_283 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 3 - 237
Target Start/End: Complemental strand, 49689314 - 49689080
Alignment:
| Q |
3 |
aaattgaaagaattgaagttgataggttttaggtttggaaaacaacttgcagttgcagtaatattccgaagaaagnnnnnnnntcagaacctttcatctc |
102 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49689314 |
aaattcaaagtattgaagttgataggttttaggtttggaaaacaacttgcagttgcagtaatattccgaagaaagaaaaaaaatcagaacctttcatctc |
49689215 |
T |
 |
| Q |
103 |
tcattaatcttcaacacagcaattttaatgacaaatcttagcattcaacttccttgacaaacataaagaatgaattgagagaaagcatactgaaatttct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49689214 |
tcattaatcttcaacacagcaattttaattacaaatcttagcattcaacttccttgacaaacataaagaatgaattgagagaaagcatactgaaatttct |
49689115 |
T |
 |
| Q |
203 |
aaatcctcctcctgctacccttttatggaattgat |
237 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||| |
|
|
| T |
49689114 |
aaatccttctccagctacccttttatggaattgat |
49689080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University