View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_288 (Length: 248)
Name: NF6867A_low_288
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_288 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 7617739 - 7617528
Alignment:
| Q |
1 |
gtaattgtaatgtgtagcgtcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctg |
100 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617739 |
gtaattgttatgtgtagttgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctg |
7617640 |
T |
 |
| Q |
101 |
tctttaaagtgnnnnnnnnccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgctaattatatttagtttatacttcaaaa |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617639 |
tctttaaagtg-aaaaaaaccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgctaattatatttagtttatacttcaaaa |
7617541 |
T |
 |
| Q |
201 |
taaattaactaac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7617540 |
taaattaactaac |
7617528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University