View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_290 (Length: 248)
Name: NF6867A_low_290
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_290 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 10575962 - 10576192
Alignment:
| Q |
18 |
gacatcatgaactattgtaagctattaagttctgtgttgaatattgcatctgtgattaacataatcaccataaattatgttaatcagaacgtcttgtcct |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10575962 |
gacatcatgaactattgtacgctattaagttctgtgttcaatattgcatctgtgattaacataatcaccataaattatgttaatcagaacttcttgtccc |
10576061 |
T |
 |
| Q |
118 |
aacgaagacccacatttttatagtgggtagctcttgccatgctatcttcatcataaattttgcatttattcacaaggatagaaaaacattagcatctcct |
217 |
Q |
| |
|
|| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576062 |
aaagaagacccacattcttatagtgagtagctcttgccatgctatcttcatcataaattttgcatttattcacaaggatagaaaaacattagcatctcct |
10576161 |
T |
 |
| Q |
218 |
ggtggccaatgaattgcatatgcaccattat |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
10576162 |
ggtggccaatgaattgcatatacaccattat |
10576192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University