View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_293 (Length: 248)
Name: NF6867A_low_293
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_293 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 41 - 240
Target Start/End: Original strand, 8840418 - 8840617
Alignment:
| Q |
41 |
ttgatatagttaaaacaagcatggcaatttgactcattataacatatataagcattactcacctagtgcaattgcactaacaagaattgtgaaggataaa |
140 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840418 |
ttgatatagttaaatcaaacatgacaatttgactcattataacatatataagcattacttacctagtgcaattgcactaacaagaattgtgaaggataaa |
8840517 |
T |
|
| Q |
141 |
acaaagataatcaaggaagctctttgaaagatattgacaagcttgtcaatgattttctgtcctatgtatgctgcaatggcagacactagggtgaggtaga |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8840518 |
acaaagataatcaaggaagctctttgaaagatattgacaagcttgtcaatgattttctgtcctatgtatgctgcaatggtagacactagggtgaggtaga |
8840617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University