View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_296 (Length: 247)
Name: NF6867A_low_296
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_296 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 45123342 - 45123582
Alignment:
| Q |
1 |
tattattttctagttgttcatggacaatgatcatagtttcgtctccgctttttgaagtttccatctatgttgtgattgtgtttccttattttctctatgt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45123342 |
tattattttctagttgtcattggacaatgatcatagtttcgtctccgctttttgaagtttctacctatgttgtgattgtgtttctttattttctctatgt |
45123441 |
T |
|
| Q |
101 |
tgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatgtatccttctatgaatgtctattacagaatattatgaatattagtgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45123442 |
tgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatatatccttctatgaatgtctattacaaaatattatgaatattagtgat |
45123541 |
T |
|
| Q |
201 |
gatgtattgattaaatgtatttttaacggtcttcatctcag |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123542 |
gatgtattgattaaatgtatttttaacggtcttcatctcag |
45123582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University