View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_305 (Length: 245)
Name: NF6867A_low_305
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_305 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 8 - 245
Target Start/End: Original strand, 23340907 - 23341150
Alignment:
| Q |
8 |
tggtgttcagaaagtttcgaaccacgctgcttgaacatatgcaggtatagtgtgagccaggtgaatagataaagtggaagttcgacctgatcgagaaaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23340907 |
tggtgttcagaaagtttcgaaccacgctgcttgaacatatgcaggtatagtgtgagccaggtgaatagaaaaagtggaagttcgacctgatcgagaaaaa |
23341006 |
T |
 |
| Q |
108 |
tgaagcataagtcaaacaaattagaacttaatcaaacaatcaacataattgaaaggaacaaattaacaatttttta------tgaaactgaacgattttc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| | ||||||| ||||||||||| |||||| |
|
|
| T |
23341007 |
tgaagcataagtcaaacaaattagaacttaatctaacaatcaacataattgaaatgaacaaattaagatttttttatgaaagtgaaactgaacaattttc |
23341106 |
T |
 |
| Q |
202 |
taactgctatatgagtcaatttcgaagactaaggttatcgaaga |
245 |
Q |
| |
|
|| ||||||||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
23341107 |
tacctgctatatgagtcaattttgaagcctaaggttatagaaga |
23341150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University