View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_317 (Length: 243)
Name: NF6867A_low_317
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_317 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 243
Target Start/End: Original strand, 12122166 - 12122388
Alignment:
| Q |
21 |
aagctttctatgaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatccttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12122166 |
aagctttctatgaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttc |
12122265 |
T |
|
| Q |
121 |
tggaggcatttccgaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtggaattggggcaaa |
220 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| | || |
|
|
| T |
12122266 |
tggaggcatttccgaatataatcttcggaggattgaggttgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaa |
12122365 |
T |
|
| Q |
221 |
tatcttctaaggtaaggtggggg |
243 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
12122366 |
tatcttctaagataaggtggggg |
12122388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 24 - 213
Target Start/End: Original strand, 14691688 - 14691877
Alignment:
| Q |
24 |
ctttctatgaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatccttctgg |
123 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||||||||| |||||||| || |||||||||||||||||||| || |||||||||||||||| |||||| |
|
|
| T |
14691688 |
ctttttatgaggctgccataattgattagtgggacccactgacctcaaaccggagattctaaaccctaatttgatactagaagattctcgatctttctgg |
14691787 |
T |
|
| Q |
124 |
aggcatttccgaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtggaattg |
213 |
Q |
| |
|
||||||||||| ||||||||||| ||||| || |||||||||||||| ||||| ||||||||||||||||| || | ||||||| ||||| |
|
|
| T |
14691788 |
aggcatttccggatgtaatcttcagaggactgtgggtgccatgttcgtgaaccgatcttgatgtcgacgacggcagggttggtgtaattg |
14691877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University