View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_318 (Length: 243)
Name: NF6867A_low_318
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_318 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 24600180 - 24599975
Alignment:
| Q |
20 |
tttatgctatttttgcatgtcttagaacgccttattacaagtctatattaatatccccttaatttttgtttactttacttttgttgtttcacaagctgcc |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24600180 |
tttatactatttttgcatgtcttagaacgccttattacatgtctatattcatatcccattaatttttgtttactttacttttgttgtttcacaagctgcc |
24600081 |
T |
 |
| Q |
120 |
ccactaagtccaaatagaaacaaacttgcgtgttgcttttataactttatattcaaacgattgtttttaacacagttcaatgaagccttaatcctttcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24600080 |
ccactaagtccaaatagaaacaaacttgcgtggtgcttttagaactttatattcaaacgattgtttttaacacagtccaatgaagccttaatcctttcaa |
24599981 |
T |
 |
| Q |
220 |
gtcaac |
225 |
Q |
| |
|
|||||| |
|
|
| T |
24599980 |
gtcaac |
24599975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University