View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_332 (Length: 242)
Name: NF6867A_low_332
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_332 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 43239346 - 43239112
Alignment:
| Q |
8 |
tgaaatgaaaagctgccaagagccaattagcataagctgtgtagagtccaataacaaagagcaatatgataccccatgtccaacctaatggaaccattat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239346 |
tgaaatgaaaagctgccaagagccaattagcataagctgtgtagagtccaataacaaagagcaatatgataccccatgtccaacctaatggaaccattat |
43239247 |
T |
|
| Q |
108 |
caggttagagaaactgaatatccaaccacagttgaagcctgtcaccaacatcaacccaacttgttgccatgaatctgcaaattgaatgaaacactcatta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43239246 |
caggttagagaaactgaatatccaaccacagttgaagcctgtcaccaacatcaaccccacttgttgccatgaatctgcaaattgaatgaaacacccatta |
43239147 |
T |
|
| Q |
208 |
gtgatgttaacaattactaacaaaccagcatagaa |
242 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
43239146 |
atgatgttaacaattactaacaaaacagcatagaa |
43239112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University