View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_333 (Length: 242)
Name: NF6867A_low_333
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_333 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 242
Target Start/End: Original strand, 31854593 - 31854828
Alignment:
| Q |
8 |
acatcagaccaattggaggtatgaagtacaacgggaaaattttatggactgttttcctgcgtgtctgtgacagcagaatttgcttctgttactgctgtct |
107 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31854593 |
acataagaccaattgaaggtatgaagtacaacgggaatattttatggactgttttcctgcgtgtctgtgacagcagaatttgcttctgttactgctgtct |
31854692 |
T |
|
| Q |
108 |
tgagcaggtctgttttgtgggg-aggcagtggagattttgtttcctgtactgttttgctgtgcgatgtgttggcgggttttgtgctgctttctgtttgct |
206 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
31854693 |
tgggcaggtctgttttgtgggggaggcagtggagattttgtttcctgtactgttttgctgtgcgatgtgttggggggttttgtgctgctttctatttgct |
31854792 |
T |
|
| Q |
207 |
ggcccgtttctagcaaaacttgggttgacttgtagg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31854793 |
ggcccgtttctagcaaaacttgggttgacttgtagg |
31854828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University