View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_341 (Length: 241)
Name: NF6867A_low_341
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_341 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 43703074 - 43703296
Alignment:
| Q |
16 |
acatcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703074 |
acatcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtt |
43703173 |
T |
 |
| Q |
116 |
taaacttggttttattcacattacttttatcaccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaattt |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703174 |
taaactttgttttattcacattacttttatcgccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaattt |
43703273 |
T |
 |
| Q |
216 |
agcttttgtgaatcaagcaaatt |
238 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
43703274 |
agtttttgtgaatcaagcaaatt |
43703296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University