View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_342 (Length: 241)
Name: NF6867A_low_342
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_342 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 7650515 - 7650304
Alignment:
| Q |
1 |
aagaatatgaacaaaaaggggaaagtatattaggggg-tatttggcaaccatgggtgtcttcagagacttctatcttttctaacaccctattttaactat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7650515 |
aagaatatgaacaaaaaggggaaagtatatcaggggggtatttggcaaccatgggtgtcttcagagacttctatcttttctaacaccctattttaactat |
7650416 |
T |
|
| Q |
100 |
gccatgtggcatgttaacttttggtttgactgagattctatgagaagctttctaatacacaatctaacaaactttcgttttatttggatacagaaaatgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
7650415 |
gccatgtggcatgttaacttttggtttgactgatattctatgagaagctttctaatacacaatctaacaaactttcgtgttatttggacccacaaaatgg |
7650316 |
T |
|
| Q |
200 |
ggcacaatactt |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7650315 |
ggcacaatactt |
7650304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 183
Target Start/End: Complemental strand, 7654608 - 7654530
Alignment:
| Q |
106 |
tggcatgtt-aacttttggtttgactgagattctatgagaagctttctaatacacaatctaacaaactttcgttttatt |
183 |
Q |
| |
|
||||||||| |||||||| || | || || ||||||||||| |||||||| ||||||| ||||||| |||||| ||||| |
|
|
| T |
7654608 |
tggcatgttcaacttttgtttcggctaagtttctatgagaatctttctaacacacaatgtaacaaattttcgtgttatt |
7654530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University