View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_351 (Length: 238)
Name: NF6867A_low_351
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_351 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 35450050 - 35449813
Alignment:
| Q |
1 |
tggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgatgaagacaaagaaaaaccattgtttgagtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35450050 |
tggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgaagaagacaaagaaaaaccattgtttgagtca |
35449951 |
T |
|
| Q |
101 |
attccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggagcattttgttgttgatggaaaactagcttttccaagagaagtcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449950 |
attccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggatcattttgttgttgatggaaaactagcttttccaagagaagtcttt |
35449851 |
T |
|
| Q |
201 |
cacatttttcttgtgcttcatctctttctctaatgatg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449850 |
gacatttttcttgtgcttcatctctttctctaatgatg |
35449813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 163 - 231
Target Start/End: Original strand, 21010633 - 21010701
Alignment:
| Q |
163 |
ttgttgatggaaaactagcttttccaagagaagtctttcacatttttcttgtgcttcatctctttctct |
231 |
Q |
| |
|
|||||| ||||||| || |||||| |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21010633 |
ttgttgttggaaaagtaacttttctaagaaaagtctttggcatttttcttgtgcttcatctctttctct |
21010701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University