View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_353 (Length: 238)
Name: NF6867A_low_353
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_353 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 15250438 - 15250238
Alignment:
| Q |
19 |
tgagtttggtgttgttttaactttttagtgcatcatgctaacagtaaataa----tattaactatcatcactttgaaacaaaatagaacccatgatacat |
114 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
15250438 |
tgagtttagcgttgttttaactttttagtgcatcatgctaacagtaaataaataatattaactatca---ctttgaaacaaaatagaacccatgacacat |
15250342 |
T |
|
| Q |
115 |
ttattaaattaaagtcattctgaccaatatcatctacaaccacatgtttcaaagaccacagaatccaccaggtcccccaaacaacacaacacgttgcaaa |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15250341 |
ttattaaattaaagtaattctgaccaatatcatctacaaccacatgttttaaagaccacagaatccaccaggtccaccaaacaacacaacacgttgcaaa |
15250242 |
T |
|
| Q |
215 |
tcat |
218 |
Q |
| |
|
|||| |
|
|
| T |
15250241 |
tcat |
15250238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University